View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11543_low_22 (Length: 348)
Name: NF11543_low_22
Description: NF11543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11543_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 20 - 338
Target Start/End: Complemental strand, 4982348 - 4982030
Alignment:
| Q |
20 |
atcttccctcagcttccctcgagacactttatggaaaagctcgccacctttcacttgttccattgcaaaatatatctttgttttgcttgccatgacctcg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4982348 |
atcttccctcagcttccctcgagacactttatggaaaagctcgccacctttcacttgttccattgcaaaatatatctttgttttgcttgccatgacctcg |
4982249 |
T |
 |
| Q |
120 |
tagaattcgacaatgttagggtgtcgaacaagacgcataaccgagatttcacgcttgatttgctccttcaaaccgactttcatgatcatcgctttgtcga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4982248 |
tagaattcgacaatgttagggtgtcgaacaagacgcataaccgagatttcacgcttgatttgctccttcaaaccgactttcatgatcatcgctttgtcga |
4982149 |
T |
 |
| Q |
220 |
acaccttgatagcaacattttgtcctgtctttaagttccttgcatggtaaactttggcaaaacttccttggccaagcatgcgtcctacctcatacttttg |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4982148 |
acaccttgatagcaacattttgtcctgtctttaagttccttgcatggtaaactttggcaaaacttccttggccaagcatgcgtcctacctcatacttttg |
4982049 |
T |
 |
| Q |
320 |
cattagaattgttcctttg |
338 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
4982048 |
cattagaattgttcctttg |
4982030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University