View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11543_low_31 (Length: 254)
Name: NF11543_low_31
Description: NF11543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11543_low_31 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 11 - 254
Target Start/End: Complemental strand, 38249755 - 38249512
Alignment:
| Q |
11 |
gtgagatgaaagattgtgaagaacattatcatgtgatgatgatgaggtgggtctcaggtacattttctatataaaaatacttcgaatagtagctagtttt |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38249755 |
gtgaaatgaaagattgtgaagaacattatcatgtgatgatgatgaggtgggtctcaggtacattttctatataaaaatacttcgaatagtagctagtttt |
38249656 |
T |
|
| Q |
111 |
ctcgtcaaacaaagctcaactctgccatttccaaactatctttctgaggaacgcaactcaagccattccatcttctcttctgcatgcttttgctccgtat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38249655 |
ctcgtcaaacaaagctcaactctgccatttccaaactatctttctgaggaacgcaactcaagccattccatcttctcttctgcatgcttttgctccgtat |
38249556 |
T |
|
| Q |
211 |
tgattgtgttcaaactatgttttttcatgcatatttgtgtagtt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38249555 |
tgattgtgttcaaactatgttttttcatgcatatttgtgtagtt |
38249512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 138 - 189
Target Start/End: Complemental strand, 18559900 - 18559846
Alignment:
| Q |
138 |
tttccaaactatctttct---gaggaacgcaactcaagccattccatcttctctt |
189 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||| ||||||||||| |
|
|
| T |
18559900 |
tttccaaactatctttcttctgaggtacgcaactcaagccatttcatcttctctt |
18559846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University