View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11543_low_32 (Length: 253)
Name: NF11543_low_32
Description: NF11543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11543_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 21 - 249
Target Start/End: Original strand, 53267415 - 53267643
Alignment:
| Q |
21 |
gtgaaatttctgggttgagtttatggataatatactcatattgatagtgcacacccctaaggctgagatattgtcctttgtactcgctcttaatggcatc |
120 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53267415 |
gtgaagtttctgggttgagtttatggataatatactcatattgatacagcacacccctaaggctgagatattgtcctttgtactcgctcttaatggcatc |
53267514 |
T |
 |
| Q |
121 |
cacgttttagttcaaccgtacctcctccattttaaaaacttcacatgcacaattttgtaatgttaaatcagttcttaagttcattcgaagtaaaaattta |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53267515 |
cacgttttagttcaaccgtacctcctccattttaaaaacttcacatgcacaattttgtaatgttaaatcagttcttaagttcattcgaagtaaaaattta |
53267614 |
T |
 |
| Q |
221 |
ttaaaagtaggtgtttttcaaacaagcgt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
53267615 |
ttaaaagtaggtgtttttcaaacaagcgt |
53267643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University