View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11543_low_38 (Length: 239)
Name: NF11543_low_38
Description: NF11543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11543_low_38 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 88 - 224
Target Start/End: Original strand, 43232045 - 43232181
Alignment:
| Q |
88 |
atataagacctctacttgatatttgttacacacagaaagctaaattgggattctcttggaagatgatttagaattcaaaatttcaaatctattgtgtgtg |
187 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43232045 |
atatgagacctctacttgatatttgttacacacagaaagctaaattgggattctcttggaagatgatgcagaattcaaaatttcaaatctattgtgtgtg |
43232144 |
T |
|
| Q |
188 |
tgtaaatgccttcatgatcccttattacatacttatt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43232145 |
tgtaaatgccttcatgatcccttattacatacttatt |
43232181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 43231969 - 43232018
Alignment:
| Q |
43 |
ccaaaaccataatatcatattatgtttacgggtcatcttacttgtatata |
92 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43231969 |
ccaaaaccataatatcatattatgtttatgggtcatcttacttgtatata |
43232018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University