View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11543_low_40 (Length: 237)
Name: NF11543_low_40
Description: NF11543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11543_low_40 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 53267689 - 53267913
Alignment:
| Q |
1 |
tgctgtcattatcaacaatgaaaaactaattttcatgaataaacgtctacccaataatattaatatggttattgttacaggcttacaggtagatttaaat |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53267689 |
tgctgtcattatcaacaacgaaaaactaattttcatgaataaacgtctacccaataatattaatatggttattgttacaggcttacaggtagatttaaa- |
53267787 |
T |
|
| Q |
101 |
attattgataagcaacaaaatatcatgatctttcatgtaggtgccataaatagtcattaccta----cttccattgaacatattataaatttgatatgat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
53267788 |
--tattgataagcaacaaaatatcatgatctttcatgtaggtgccataaatagtcattacctacttccttccattgaacacattataaatttgatatgat |
53267885 |
T |
|
| Q |
197 |
gctcactagacacgtaaacatatttatt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
53267886 |
gctcactagacacgtaaacatatttatt |
53267913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University