View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11543_low_41 (Length: 227)
Name: NF11543_low_41
Description: NF11543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11543_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 9e-94; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 18 - 211
Target Start/End: Complemental strand, 8168033 - 8167840
Alignment:
| Q |
18 |
aaggtgacattggaaattcgaaaaacaacatgggaaaatcttagacatgccaaatgaacatcaaatttagtgttttcccttgagaagaaacttttgcagc |
117 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8168033 |
aaggtgacattggaaattcgacaaacaacaatggaaaatcttagacatgccaaatgaacatcaaatttagtgttttcccttgagaaggaacttttgcagc |
8167934 |
T |
 |
| Q |
118 |
caaaaagcagagtacttgggatatcttttcaaattgttaacgaaatcgacataaattattccaaatcgtactgtgtaccctgcatcccattcat |
211 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8167933 |
caaaaagcagagtacttgggatatctcttcaaattgttaacgaaatcgacataaattattccaaatcgtactgtgtaccctgcatcccattcat |
8167840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 211
Target Start/End: Complemental strand, 8143211 - 8143018
Alignment:
| Q |
18 |
aaggtgacattggaaattcgaaaaacaacatgggaaaatcttagacatgccaaatgaacatcaaatttagtgttttcccttgagaagaaacttttgcagc |
117 |
Q |
| |
|
||||||||| ||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8143211 |
aaggtgacactggaaattcgacaaacaacaatggaaaatcttagacatgccaaatgaacatcaaatttagtgttttcccttgagaaggaacttttgcagc |
8143112 |
T |
 |
| Q |
118 |
caaaaagcagagtacttgggatatcttttcaaattgttaacgaaatcgacataaattattccaaatcgtactgtgtaccctgcatcccattcat |
211 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8143111 |
caaaaagcagagtacttgggatatctcttcaatttgttaacgaaatccacataaattattccaaatcgtactgtgtaccctgcatcccattcat |
8143018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University