View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11543_low_43 (Length: 227)
Name: NF11543_low_43
Description: NF11543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11543_low_43 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 20 - 211
Target Start/End: Complemental strand, 31943969 - 31943775
Alignment:
| Q |
20 |
ttatttctatgattgcatgttgaaaattcggtgtttatgttattttgtttgattt-atgttgaaagnnnnnnnnnnn--agggtttatttcttcacatgt |
116 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
31943969 |
ttatttctatgattacatgttgaaaattcggtgtttatgttattttgtttgattttatgttgaaagtttttttttttttagggtttatttcttcatatgt |
31943870 |
T |
|
| Q |
117 |
tgaaaattttgttttcagggtttatttcttcatgttggaaattatattttaattgacatgatttcatgctgaaaattgtttgttttatggttcat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
31943869 |
tgaaaattttgttttcagggtttatttcttcatgttggaaattatattttaattgacatgatttcttgctgaaaattgtgtgttttatggttcat |
31943775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 113 - 211
Target Start/End: Complemental strand, 1341981 - 1341881
Alignment:
| Q |
113 |
atgttgaaaattttgttttc-agggtttatttcttcatgttggaaattatattttaatt-gacatgatttcatgctgaaaattgtttgttttatggttca |
210 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||| |||||||||||| ||||| || ||||||||||| |||| |||||||| |||||||||||||| |
|
|
| T |
1341981 |
atgttcaaaattttgttttttagggtttatttcttcttgttggaaattaaatttttctttgacatgatttcttgcttaaaattgtgtgttttatggttca |
1341882 |
T |
|
| Q |
211 |
t |
211 |
Q |
| |
|
| |
|
|
| T |
1341881 |
t |
1341881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 74
Target Start/End: Complemental strand, 1342036 - 1341983
Alignment:
| Q |
20 |
ttatttctatgattgcatgttgaaaattcggtgt-ttatgttattttgtttgattt |
74 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
1342036 |
ttatttctttgattgcatgttgaaaatt--gtgtattatgttattttgtttgattt |
1341983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University