View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11544_high_4 (Length: 222)
Name: NF11544_high_4
Description: NF11544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11544_high_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 1999432 - 1999226
Alignment:
| Q |
1 |
tttgaagcaattggttgcattgtatgaaattttgttaatataa-cttcatggatagaaactggatacataaatatatat--gaggataatgtaattgcat |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1999432 |
tttgaagcaattggttgcattgtatgaaattttgtaaatataaacttcatggatagaaactggatacataaatatatatttgaggataatgtaattgcat |
1999333 |
T |
|
| Q |
98 |
gtagtagtcttgttatcaaatttatcgtttcaggtgaagaaattgattgcattgcatggaatattgttatttgttaaacataatttcatggatagaaact |
197 |
Q |
| |
|
|| ||||||||||||||||| | || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1999332 |
gtggtagtcttgttatcaaagtcattgtttcaggtgaagaaattgattgcattgcatggaatattgttatttgttaaacataatttcatggatagaaact |
1999233 |
T |
|
| Q |
198 |
gaataag |
204 |
Q |
| |
|
||||||| |
|
|
| T |
1999232 |
gaataag |
1999226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University