View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11545_high_10 (Length: 214)
Name: NF11545_high_10
Description: NF11545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11545_high_10 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 110 - 214
Target Start/End: Complemental strand, 44996545 - 44996441
Alignment:
| Q |
110 |
cattaatggggaaacaatgatagtaaagaatggggttactatttactatttcatgagtgacgagatgtgaagcagaagcagtgatgcagggatcaaagta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44996545 |
cattaatggggaaacaatgatagtaaagaatggggttactatttactatttcatgagtgacgagatgtgaagcagaagcagtgatgcagggatcaaagta |
44996446 |
T |
 |
| Q |
210 |
cgtac |
214 |
Q |
| |
|
||||| |
|
|
| T |
44996445 |
cgtac |
44996441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 11 - 82
Target Start/End: Complemental strand, 44996644 - 44996573
Alignment:
| Q |
11 |
cagagaaaatctcactgaggtttttagctgtttataatacagaagagagactagctcgttaaggaaacagac |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44996644 |
cagagaaaatctcactgaggtttttagctgtttgtaatacagaagagagactagctcgttaaggaaacagac |
44996573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University