View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11545_low_1 (Length: 431)
Name: NF11545_low_1
Description: NF11545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11545_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 1e-94; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 225 - 416
Target Start/End: Complemental strand, 44880619 - 44880429
Alignment:
| Q |
225 |
gataactttttgtagtaggaaactcccaaaatcaaccatactcacctccaaagaagatttgagtatatcattcttttgggatgaatattgatgattttga |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44880619 |
gataactttttgtagtaggaaactcccaaaatcaaccatactcacc-ccaaagaagatttgagtatatcattcttttggggtgaatattgatgattttga |
44880521 |
T |
 |
| Q |
325 |
gagcttccttctgcaacaagttttaaattgaactctggctaagttcagttcatcttaaaataatgtttcaggttcatcgttaagataaaatt |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44880520 |
gagcttccttctgcaacaagttttaaattgaactttggctaagttcagttcatcttaaaataatgtttcaggttcatcgttaagataaaatt |
44880429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 9 - 135
Target Start/End: Complemental strand, 44880841 - 44880715
Alignment:
| Q |
9 |
agaagaaccatgagagatcacgctcaagagaaggacaatgacaaggcggagaaatcaacattaacgatgccaatgtcatcctttccaagcttgataggaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44880841 |
agaagaaccatgagagatcacgctcaagagaaggacaatgacaaggcggagaaatcaacattaacgatgccaatgtcatcctttccaagcttgataggaa |
44880742 |
T |
 |
| Q |
109 |
atattctcttaatgagaacctaaactg |
135 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
44880741 |
atattctcttaatgagaacctaaactg |
44880715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 35 - 82
Target Start/End: Original strand, 44880355 - 44880402
Alignment:
| Q |
35 |
agagaaggacaatgacaaggcggagaaatcaacattaacgatgccaat |
82 |
Q |
| |
|
||||||| ||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
44880355 |
agagaagaacaatgacaaggctgagaaatcaatattaacgatgccaat |
44880402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University