View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11545_low_10 (Length: 218)
Name: NF11545_low_10
Description: NF11545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11545_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 44996459 - 44996259
Alignment:
| Q |
1 |
cagggatcaaagtacgtacagctgcaagggttgcaggttgtttcagttggtcttaaagcaaacactgtaaagttgnnnnnnnn-ggctgattaattcatg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44996459 |
cagggatcaaagtacgtacagctgcaagggttgcaggttgttccagttggtcttaaagcaaacactgtaaagttgaaaaaaaaaggctgattaattcatg |
44996360 |
T |
 |
| Q |
100 |
atgtgtgtgtactttcgaagaccattgcttccaatttccaacccatgccaacacatgagctaccataaaccattaatagaggtgaagtgaggtggagggt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44996359 |
atgtgtgtgtactttcgaagaccattgcttccaatttccaacccatgccaacacatgagctaccataaaccattaatagaggtgaagtgaggtggagggt |
44996260 |
T |
 |
| Q |
200 |
g |
200 |
Q |
| |
|
| |
|
|
| T |
44996259 |
g |
44996259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University