View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11546_high_25 (Length: 240)
Name: NF11546_high_25
Description: NF11546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11546_high_25 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 19 - 240
Target Start/End: Original strand, 45066391 - 45066601
Alignment:
| Q |
19 |
ttgtacatatcaaatagagtactatatgagggataatataaatagtaaattctttttcaatgataagctagtgaattggttatgagaatagctataatta |
118 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
45066391 |
ttgtacatatcaaatagagtactacatgagggataatataaatagtaaattctttttcaatgataagctagtgaattggttatgagaatagcta----ta |
45066486 |
T |
 |
| Q |
119 |
agctgtaaacttttacagtttattcgtaatctaaataacaataatcaataatgtcatctatatgaagctcgtatcttatctcaatattgttgtaaacatt |
218 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45066487 |
agctgtaaacttttacggtttattcgtaatctaaataa-------caataatgtcatctatatgaagctcgtatcttatctcaatattgttgtaaacatt |
45066579 |
T |
 |
| Q |
219 |
gaaaatcataaaataagtcttt |
240 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
45066580 |
gaaaatcataaaataagtcttt |
45066601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 32 - 95
Target Start/End: Original strand, 45546045 - 45546108
Alignment:
| Q |
32 |
atagagtactatatgagggataatataaatagtaaattctttttcaatgataagctagtgaatt |
95 |
Q |
| |
|
||||| || ||||||||||||||||||| | |||||||||||||||||||||| ||| |||| |
|
|
| T |
45546045 |
atagaatattatatgagggataatataattttgaaattctttttcaatgataagcaagttaatt |
45546108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University