View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11546_low_22 (Length: 253)
Name: NF11546_low_22
Description: NF11546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11546_low_22 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 15 - 253
Target Start/End: Complemental strand, 45445436 - 45445198
Alignment:
| Q |
15 |
atgaaaatctaccgttaagaaaatgtttttgttggcgaccaacacgacgagaattgacttcgtcctacaggagtttctgttatcttcactagccttttat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45445436 |
atgaaaatctaccgttaagaaaatgtttttgttggcgaccaacacgacgagaattgacttcgtcctacaggagtttctgttatcttcactagccttttat |
45445337 |
T |
 |
| Q |
115 |
ttcgattcttttgatgagagtatggtatccacgtactagctggggatccacttctatactcagaattttcatgcaagggtttctaatctttaatgatgaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45445336 |
ttcgattcttttgatgagagtatggtatcc----actagctggggatccacttctatactcagaattttcatgcaagggtttctaatctttaatgatgaa |
45445241 |
T |
 |
| Q |
215 |
agcatcggata----atatttattgtgaagcaggttacaaaga |
253 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
45445240 |
agcatcggataatatatatttattgtgaagcagattacaaaga |
45445198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University