View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11546_low_25 (Length: 242)
Name: NF11546_low_25
Description: NF11546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11546_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 170
Target Start/End: Original strand, 40399969 - 40400138
Alignment:
| Q |
1 |
tcatgtttatgattatccatgattctgaagtttcaactctcaaccatactatgcatgcagaccatggtccacatcccactaccagagttatggcgggttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40399969 |
tcatgtttatgattatccatgattctgaagtttcaactctcaaccatactatgcatgcagaccatggtccacatcccactaccagagttatggcgggttg |
40400068 |
T |
 |
| Q |
101 |
acgctgagatttgaggttgaaaatccatgttagtgtttctctaagttactatcatattggtacaaaatgt |
170 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40400069 |
acgctgagatgtgaggttcaaaatccatgttagtgtttctctaagttactatcatattggtacaaaatgt |
40400138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 184 - 221
Target Start/End: Original strand, 40400160 - 40400197
Alignment:
| Q |
184 |
ttaagaacgattgatttccgtcgaaaacctataggata |
221 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40400160 |
ttaagaacgattgattttcgtcgaaaacctataggata |
40400197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University