View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11546_low_27 (Length: 236)
Name: NF11546_low_27
Description: NF11546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11546_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 12052653 - 12052435
Alignment:
| Q |
1 |
tgcaagggggagagagatataagaatggaaaaaagacatgacgaaaaagaagcacgatgatggaatctccagtggaaatggtttcatttgtgggtcattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12052653 |
tgcaagggggagagagatataagaatggaaaaaagacatgacgaaaaagaagcacgatgatggaatctccagtggaaatggtttcatttgtgggtcattc |
12052554 |
T |
 |
| Q |
101 |
tagtgagaaatcttctgaattcttgtctcaacacatgaacttcaaagtaattcgaaattgccaagacgattgaagatttgcatagaaattgaacttaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
12052553 |
tagtgagaaatcttctgaattcttgtctcaacacatgaacttcaaagtaattcgaaattgccaagacgattggagatttgcatagaaattgaacttaaaa |
12052454 |
T |
 |
| Q |
201 |
gggtgtgtatggccggtag |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
12052453 |
gggtgtgtatggccggtag |
12052435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 75 - 192
Target Start/End: Original strand, 52953373 - 52953490
Alignment:
| Q |
75 |
gaaatggtttcatttgtgggtcattctagtgagaaatcttctgaattcttgtctcaacacatgaacttcaaagtaattcgaaattgccaagacgattgaa |
174 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||| || |||||||| | ||||| | |||||| || ||||||| ||||| ||||| | |
|
|
| T |
52953373 |
gaaatggtttcatctgtgggtcattcttgtgagaaatcttctgatttgttgtctcagtatatgaattacaaagtgtttggaaattgtcaagatgattgga |
52953472 |
T |
 |
| Q |
175 |
gatttgcatagaaattga |
192 |
Q |
| |
|
| |||||| ||||||||| |
|
|
| T |
52953473 |
gttttgcacagaaattga |
52953490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University