View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11547_high_6 (Length: 436)
Name: NF11547_high_6
Description: NF11547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11547_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 195 - 418
Target Start/End: Complemental strand, 17559839 - 17559615
Alignment:
| Q |
195 |
gcgcaggtttctaaagcaagtgaactgtgacacatattttagctatatatata--aagtacataagtcaaatttttggacaaataattgttacaaatact |
292 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17559839 |
gcgcaggtttctaaagca-gtgaactgtgactcataatttagctatatatatataaagtacataagtcaaatttttggacaaataattgttacaaatact |
17559741 |
T |
|
| Q |
293 |
cccgtgctactcttaattgttgcggtttcaattgcattttgcagtcagattgatttactgcacaatatcactttctgactatgaaatttctgcatatttg |
392 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17559740 |
cctgtgctactcttaattgttgcggtttcaattgcattttgtagtcagattgatttactgcacaatatcactttctggctatgaaatttctgcatatttg |
17559641 |
T |
|
| Q |
393 |
atatttcaattctgcatttttatctg |
418 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
17559640 |
atatttcaattctgcatttttatctg |
17559615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University