View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11547_low_16 (Length: 281)
Name: NF11547_low_16
Description: NF11547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11547_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 20 - 270
Target Start/End: Original strand, 47280089 - 47280339
Alignment:
| Q |
20 |
atctgaaggaagaatagctatctgtctaaaacattcacttgaggggaaataatttgtctggatatccttgctgttttgcaagtgatcaaaccatatggac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47280089 |
atctgaaggaagaatagctatctgtctaaaacattcacttgaggggaaataatttgtctggatatccttgctgttttgcaagtgatcaaaccatatggac |
47280188 |
T |
 |
| Q |
120 |
attggcattccccgaagtatattctgattatcgggagttatggccaaactgcccgttcagaccagctggagtgttcagattaccaactatcccagcaggt |
219 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47280189 |
attggcgttccccgaagtatattctgattatcgggagttatggccaaactgcccgttcagaccagctggagtgttcagattaccaactatcccagcaggt |
47280288 |
T |
 |
| Q |
220 |
gaaaaggatctgatagtattattgtgaaaatgtccagaactatccattctt |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47280289 |
gaaaaggatctgatagtattattgtgaaaatgtccagaactatccattctt |
47280339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 85 - 163
Target Start/End: Original strand, 49059873 - 49059951
Alignment:
| Q |
85 |
ccttgctgttttgcaagtgatcaaaccatatggacattggcattccccgaagtatattctgattatcgggagttatggc |
163 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |||| |||||||||||| ||||||||||||| |
|
|
| T |
49059873 |
ccttgctgttttgcaagtgatcaaaccctatggacattggcattccctgaagaatattctgattaacgggagttatggc |
49059951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 169 - 269
Target Start/End: Original strand, 49060037 - 49060137
Alignment:
| Q |
169 |
tgcccgttcagaccagctggagtgttcagattaccaactatcccagcaggtgaaaaggatctgatagtattattgtgaaaatgtccagaactatccattc |
268 |
Q |
| |
|
|||||||| |||| || |||||||||||||||||||| ||||||| ||||||||||||||||| || ||||||||||||||||||||||| | |||||| |
|
|
| T |
49060037 |
tgcccgttaagactagttggagtgttcagattaccaattatcccactaggtgaaaaggatctgaaagcattattgtgaaaatgtccagaaccacccattc |
49060136 |
T |
 |
| Q |
269 |
t |
269 |
Q |
| |
|
| |
|
|
| T |
49060137 |
t |
49060137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 82
Target Start/End: Original strand, 49059514 - 49059576
Alignment:
| Q |
20 |
atctgaaggaagaatagctatctgtctaaaacattcacttgaggggaaataatttgtctggat |
82 |
Q |
| |
|
|||||||||| ||| |||| |||||||||||||||||||||| | |||| ||||||| ||||| |
|
|
| T |
49059514 |
atctgaaggaggaacagctgtctgtctaaaacattcacttgaagagaaagaatttgtttggat |
49059576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 43 - 82
Target Start/End: Original strand, 16515448 - 16515487
Alignment:
| Q |
43 |
gtctaaaacattcacttgaggggaaataatttgtctggat |
82 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16515448 |
gtctaaaacattcacttgaagggaaataatttgtctggat |
16515487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University