View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11547_low_21 (Length: 239)
Name: NF11547_low_21
Description: NF11547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11547_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 13 - 216
Target Start/End: Complemental strand, 35970586 - 35970383
Alignment:
| Q |
13 |
agcatagggtaaacaccatatacacaattttttatctagatatatcctaatatatgcatacataattacataccataccaagcaagttgaagaagttgga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35970586 |
agcatagggtaaacaccatatacacaattttttatctagatatatcctcatatatgcatacataattacataccataccaagcaagttgaagaagttgga |
35970487 |
T |
|
| Q |
113 |
ttggtaatgtctagactaaagataaacatgcatgtggtttaaaatgagccatttgccaataatttctcttcaatttccaaactctattattgcatatgat |
212 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35970486 |
ttggtaatgtctagactaaagataagcatgcatgtggtttaaaatgagccatttgccaataatttctcttcaatttccaaactctattattgcatatgat |
35970387 |
T |
|
| Q |
213 |
tctg |
216 |
Q |
| |
|
|||| |
|
|
| T |
35970386 |
tctg |
35970383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University