View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11548_high_4 (Length: 249)
Name: NF11548_high_4
Description: NF11548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11548_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 52725351 - 52725573
Alignment:
| Q |
18 |
cgaaaattgcatattaagtgatatttgtgtcaaaaggagaggatggcgannnnnnn-attaatttacaaaatagttgaattaaaatgtaatttatggtat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52725351 |
cgaaaattgcatattaagtgatatttgtgtcaaaaggagaggatggcgattttttttattaatttacaaaatagttgaattaaaatgtaatttatggtat |
52725450 |
T |
 |
| Q |
117 |
taattaagttttgagaagagttgcttcgcttaagatgtttctattaaattccatatgatcaaaattgagtcaaatgcatcattttccttactctcttcac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52725451 |
taattaagttttgagaagagttgcttcgcttaagatgtttctattaaattccatatgatcaaaattgagtcaaatgcatcattttccttactctcttcac |
52725550 |
T |
 |
| Q |
217 |
aatttcttgttttttgacctatg |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
52725551 |
aatttcttgttttttgacctatg |
52725573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University