View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11548_low_5 (Length: 236)
Name: NF11548_low_5
Description: NF11548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11548_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 104 - 223
Target Start/End: Complemental strand, 34719931 - 34719812
Alignment:
| Q |
104 |
aattatgtttgttattacaggtactaagagaccgtctccggattatgacgatgaagattatgataatgatccttttgcaccgaagaaggtaattgatcca |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34719931 |
aattatgtttgttattacaggtactaagagaccgtctccggattatgacgatgaagattatgataatgatccttttgcaccgaagaaggtaattgatcca |
34719832 |
T |
|
| Q |
204 |
ttactcgaatctgttatgtg |
223 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
34719831 |
ttactcgaatctgttatgtg |
34719812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 4 - 46
Target Start/End: Complemental strand, 34720030 - 34719988
Alignment:
| Q |
4 |
taggatttcgatttcggaggtgaaattggtggaaggcattcag |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34720030 |
taggatttcgatttcggaggtgaaattggtggaaggcattcag |
34719988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University