View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11548_low_6 (Length: 213)
Name: NF11548_low_6
Description: NF11548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11548_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 47215154 - 47214955
Alignment:
| Q |
1 |
tttacccccactaattttgtctctatccattcttctacaactgttggctggttgagattgttccggaaacaattttgtaaaatatcggccatggtggata |
100 |
Q |
| |
|
|||| ||||||||| ||||||| ||| |||||||||||||||||| ||| |||||||||| | ||| |||||| |||| ||||||||||||||||||||| |
|
|
| T |
47215154 |
tttatccccactaaatttgtctttatacattcttctacaactgttagctagttgagattgattcggcaacaatgttgtcaaatatcggccatggtggata |
47215055 |
T |
|
| Q |
101 |
tcaatggtggttctagggctatcgcccatggtaaatttcggcaagtatggtgggttttcccgccataatcggttggtatgacacgggattttggctctct |
200 |
Q |
| |
|
||||||| || | ||||||||||||||||||| |||||| || | ||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47215054 |
tcaatggcgggtatagggctatcgcccatggtcaatttcagccaatatggtgggatttcccgccataatcggttggtatgatacgggattttggctctct |
47214955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University