View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11549_high_16 (Length: 277)
Name: NF11549_high_16
Description: NF11549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11549_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 24580221 - 24579954
Alignment:
| Q |
1 |
ttggcttaatgaacaaaggttttatagaagactagtaggtaacatatagttggttcttggaggtggtgtgcatgtg------ttttggaagagatgtgtg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
24580221 |
ttggcttaatgaacaaaggttttatagaagactagtaggtaacatattgttgattcttggaggtggtatgcatgtgcatatgttttggaagagatgtgtg |
24580122 |
T |
 |
| Q |
95 |
catatattagcaaaaagaaatggttggtttagggagaaaaatgcactggcttaccctaggttccaatgaatcgtctattttgtacttcctattaggattt |
194 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24580121 |
catatattagcaaagagaaatggttggtttagggtgaaaaacgcactggcttaccctagattccaatgaatcgtctattttgtacttcctattaggattt |
24580022 |
T |
 |
| Q |
195 |
aggagttaggggtgcgatgtaattggtcattcgatgcattgatggtgattttgtaggggccaaatatg |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
24580021 |
aggagttaggggtgcgatgtaattggtcattcgatgcattgatggtgattttgtgggggtcaaatatg |
24579954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University