View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11549_low_19 (Length: 238)

Name: NF11549_low_19
Description: NF11549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11549_low_19
NF11549_low_19
[»] chr1 (1 HSPs)
chr1 (1-188)||(114882-115069)


Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 115069 - 114882
Alignment:
1 tcaagttctcaagttaacgacacaaaaattaattcagtaaatataaacatggtcaattgctttatgggatatacatgagtataacttagcttttcaccgt 100  Q
    ||||| ||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||    
115069 tcaaggtctcaagctaacgacacaaaaattaattcagtaaatataaaaatggtcaattgctttatgggatatacatgagtataacttagcttttcactgt 114970  T
101 tacattgtctttatcgtttcatttctatcctcctaattaatgagataacaatagagaaagtgacatgatagatatgatataatagaaa 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
114969 tacattgtctttatcgtttcatttctatcctcctaattaatgagataacaatagagaaagtgacatgatagatatgatataatagaaa 114882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University