View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11549_low_23 (Length: 212)
Name: NF11549_low_23
Description: NF11549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11549_low_23 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 71 - 212
Target Start/End: Original strand, 115540 - 115680
Alignment:
| Q |
71 |
atgatgtgttgatgtgaaatgtttcctgcattagccaaatgtgataagttgcggggaaaggagatgattaagataagaccctaaaattaaaatgatgatg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
115540 |
atgatgtgttgatgtgaaatgtttcctgcattagccaaatgtgataagttgcggggaaaggagatgattaagataagaccctaaaattaaaatgatgctg |
115639 |
T |
 |
| Q |
171 |
cgtacgtattctaagttgattttttcaaagaacgacactcta |
212 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
115640 |
cgtacgtattctaaattga-tttttcaaagaacgacactcta |
115680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 115355 - 115426
Alignment:
| Q |
1 |
tatggtcatagtcttgattggatatatattttaaagtttcatgcagagttattatcaaattaagagccatat |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
115355 |
tatggtcatagtcttgattggatatatattttaaagtttcatgcagagttattatcaaattaagagccatat |
115426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University