View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1154_high_20 (Length: 250)
Name: NF1154_high_20
Description: NF1154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1154_high_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 51 - 239
Target Start/End: Complemental strand, 42161288 - 42161100
Alignment:
| Q |
51 |
ggtatacggcgggtgcggttgcttctatacgtttagagttagcacaccccatttcctcttatgttgttttccaaattgccaaaaggatatctggctggag |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42161288 |
ggtatacggcgggtgcggttgcttctatacgtttagagttagcacaccccatttcctcttatgttgttttccaaattgccaaaaggatatctggctggag |
42161189 |
T |
 |
| Q |
151 |
tgggttgtgagtttcgctaaaatgttcactcacatataatccatatatacattttactaactactataaaagaaatatagattagaatt |
239 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42161188 |
tgggttgtgagtttcactaaaatgttcactcacatataatccatatatacattttactaactactataaaagaaatatagattggaatt |
42161100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University