View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1154_high_23 (Length: 234)
Name: NF1154_high_23
Description: NF1154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1154_high_23 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 12 - 234
Target Start/End: Complemental strand, 5033141 - 5032917
Alignment:
| Q |
12 |
ttatgttatgtgtaaaaggaatcaaatagttgttgtcgttatggaagnnnnnnnnnnnnnnn-ggttacaatcgttatggaaggtttcatcgcactaatt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5033141 |
ttatgttatgtgtaaaaggaatcaaatagttgttgtccttatggaaggtttttttttttttttggttacaatcgttatggaaggtttcatcgcactaatt |
5033042 |
T |
 |
| Q |
111 |
aacgacactgttttagattttccctaatccttttacaaatagtgccgttttgtttatagatagataatttgat-aagtagtgctaccggtaactttccaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5033041 |
aacgacactgttttagattttccctaatccttttacaaatagtgcctttttgtttatagatagataatttgataaagtagtgctaccggtaactttccaa |
5032942 |
T |
 |
| Q |
210 |
aatcattttttattttattgtaaaa |
234 |
Q |
| |
|
| ||||||| ||||||||||||||| |
|
|
| T |
5032941 |
actcattttgtattttattgtaaaa |
5032917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University