View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1154_high_9 (Length: 340)
Name: NF1154_high_9
Description: NF1154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1154_high_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 28 - 262
Target Start/End: Complemental strand, 1435035 - 1434801
Alignment:
| Q |
28 |
caatttccccattaatattcttttcctccttatcttcttaagcatataaatagaatcatattcgtacctatggaggaatatgtaatgtaacttttaacaa |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1435035 |
caatttccccattaatattcttttcctccttatcttcttaagcatataaatagaatcatattcgtaccgatggaggaatatgtaatgtaacttttaacaa |
1434936 |
T |
|
| Q |
128 |
gtgggtcctactaccgtagcaggcccacataaatggcttggtatgaggggtccatcatgtctgctaaccagttaccagcttcattgcagctggatgtggc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1434935 |
gtgggtcctactaccctagcaggcccacataaatggcttggtatgaggggtccatcatgtctgctaaccagttaccagcttcattgcagctggatgtggc |
1434836 |
T |
|
| Q |
228 |
ccacttcttggataaattctaaccaatcattgcta |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
1434835 |
ccacttcttggataaattctaaccaatcattgcta |
1434801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 259 - 331
Target Start/End: Complemental strand, 26542143 - 26542071
Alignment:
| Q |
259 |
gctaataatgtttcattacaatttgttcagcctgtctagcccaggttttaaaacaccggtaaattgttcattt |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26542143 |
gctaataatgtttcattacaatttgttcagcctgtctagcccaggttttaaaacaccggtaaattgttcattt |
26542071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University