View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1154_low_12 (Length: 378)
Name: NF1154_low_12
Description: NF1154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1154_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 3e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 98 - 289
Target Start/End: Original strand, 14281385 - 14281582
Alignment:
| Q |
98 |
cactgaacaaatcgctccttacttggccatgttttttgccggtaacttcacactcgtcgctctttcttcatccattttatgtttgttaagctcatctcat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14281385 |
cactgaacaaatcgctccttacttggccatgttttttgccggtaacttcacactcattgctctttcttcatccattttatgtttgttaagctcatctcat |
14281484 |
T |
 |
| Q |
198 |
ctc------nnnnnnnnnaggttgctttggcctcacactcctaagttgcttcttcatttaccgggtattagagtttcacattattccttttcattcat |
289 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14281485 |
ctcatctcttttttttttaggttgctttggcctcacactcctaagttgcttcttcatttaccgggtattagagtttcacattattccttttcattcat |
14281582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University