View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1154_low_18 (Length: 337)
Name: NF1154_low_18
Description: NF1154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1154_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 8e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 56401279 - 56401155
Alignment:
| Q |
1 |
gagcatcgattatacaatgcttattgcgtgtacatacataacagtttgattctaatacagcaccccccnnnnnnntaaacatctcctatattacacgcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
56401279 |
gagcatcgattatacaatgcttattgcgtgtacatacataacagtttgattctaatacagcaccccccaaaaaaataaacatctcctatattacacgcat |
56401180 |
T |
 |
| Q |
101 |
tttggggggacagggtttagtatgc |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
56401179 |
tttggggggacagggtttagtatgc |
56401155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 180 - 235
Target Start/End: Complemental strand, 56401091 - 56401036
Alignment:
| Q |
180 |
ttgcaatactctcttgactatttacaaacacattgttcttgcttgacactccaatg |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56401091 |
ttgcaatactctcttgactatttacaaacacattgttcttgcttgacactccaatg |
56401036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University