View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1154_low_25 (Length: 261)
Name: NF1154_low_25
Description: NF1154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1154_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 56401549 - 56401796
Alignment:
| Q |
1 |
cttaataagtttaaaaaatatctatttattcttctctctcggattgagtgtttatctttcaagtaactttagtttcaaatatccttcatttgctcgtcgt |
100 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56401549 |
cttaagaaggttaaaaaatatctatttattcttctcgctctgattgagtgtttatctttcaagtaactttagtttcaaatatccttcatttgctcgtcgt |
56401648 |
T |
 |
| Q |
101 |
tatatgaggttgttaggagaaaatgggttgcacctgaaatagtatattttaatatttttgtgtttgttgtgtaaagaaattcaagtttatagcattctca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56401649 |
tatatgaggttgttaggagaaaatgggttgcacctgaaatagtatattttaatatttttgtgtttgttgtgtaaagaaattcaagtttatagcattctca |
56401748 |
T |
 |
| Q |
201 |
agagatgtggcattagttgattttattgaatttgggtcctctttacct |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56401749 |
agagatgtggcattagttgattttattgaatttgggtcctctttacct |
56401796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University