View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1154_low_30 (Length: 244)
Name: NF1154_low_30
Description: NF1154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1154_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 24 - 240
Target Start/End: Complemental strand, 6026345 - 6026129
Alignment:
| Q |
24 |
aatacaatattcaaggactatagaatgaaggaccacacttgcatttccaactctcaggctcataatttgcatacataatccccaaatggcttgttctgct |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6026345 |
aatacaatattcaaggactatagaatgaaggaccacacttgcatttccaactctcaggctcataatttgcatacataatccccaaatggcttgttctgct |
6026246 |
T |
|
| Q |
124 |
tggtacttgagtagcttcacatggaaaacaaccataacatttatgctcacagcttggtggacttgaccctattttactcacttctctatcattttctacc |
223 |
Q |
| |
|
||| ||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6026245 |
tggcacttgagtagcttcacatggaaaacaatcatagcatttatgctcacagcttggtggacttgaccctattttactcacttctctatcattttctacc |
6026146 |
T |
|
| Q |
224 |
tccatattcttcgacat |
240 |
Q |
| |
|
||| | ||||| ||||| |
|
|
| T |
6026145 |
tcccttttctttgacat |
6026129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 38 - 97
Target Start/End: Complemental strand, 42824335 - 42824276
Alignment:
| Q |
38 |
ggactatagaatgaaggaccacacttgcatttccaactctcaggctcataatttgcatac |
97 |
Q |
| |
|
||||| ||||| ||||||||||| ||||||||||| || ||||||||||||||||||||| |
|
|
| T |
42824335 |
ggactgtagaaggaaggaccacatttgcatttccagctttcaggctcataatttgcatac |
42824276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 122 - 195
Target Start/End: Complemental strand, 42824239 - 42824166
Alignment:
| Q |
122 |
cttggtacttgagtagcttcacatggaaaacaaccataacatttatgctcacagcttggtggacttgaccctat |
195 |
Q |
| |
|
||||| |||||| | |||||||||||| || |||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
42824239 |
cttggaacttgaatggcttcacatggattgcatccataacacttgtgctcacagcttggtggacttgaccctat |
42824166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University