View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1154_low_36 (Length: 217)
Name: NF1154_low_36
Description: NF1154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1154_low_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 36333223 - 36333015
Alignment:
| Q |
1 |
ttctgaaatctgttgggatctgtgctgtttttacgtgaccaagaagatagtacaaattcaaaacagtaaataaagaaagaccaaactttcccttagttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36333223 |
ttctgaaatctgttgggatctgtgctgtttttacgtgaccaagaagatagtacaaattcaaaacagtaaataaagaaagaccaaactttcccttagttta |
36333124 |
T |
|
| Q |
101 |
tgggatatggaaacagataactaagtgatttaacactttaacagtatcagtgatta--nnnnnnnactattaaccttttctttggctgctgctgatattt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36333123 |
tgggatatggaaacagataactaagtgatttaacactttaacagtatcagtgattatttttttttactattaaccttttctttggctgctgctgatattt |
36333024 |
T |
|
| Q |
199 |
gattctgtg |
207 |
Q |
| |
|
||||||||| |
|
|
| T |
36333023 |
gattctgtg |
36333015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University