View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1154_low_7 (Length: 424)
Name: NF1154_low_7
Description: NF1154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1154_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 20 - 335
Target Start/End: Original strand, 10598818 - 10599133
Alignment:
| Q |
20 |
gacatcatcaggtttcacacctgttttgagcatatcatagaacaattctagtgcttttgtagcaaacccatgttttgcaaaaccatttatgatagaggtc |
119 |
Q |
| |
|
|||||||| ||| ||||||||||||| ||||||| ||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10598818 |
gacatcattaggcttcacacctgtttcaagcatattatagaacaattctagtgcttttgaagcaaatccatgttttgcaaaaccatttatgatagaggtc |
10598917 |
T |
 |
| Q |
120 |
caagttatgacattgcgatcttccatgtcattaaagacctgtaaagcagcttctttgtttccacacttagaatacatagagatcaaagcattattaacac |
219 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10598918 |
caagttatgacattgcaatcttccatgtcattaaagacctgtaaagcagcttctttgtttccacacttggaatacatagagatcaaagcattattaacac |
10599017 |
T |
 |
| Q |
220 |
ttaggtcagtccgaaatcccatcttcaccaccatggcatgaatttgttcacccttacctattgtgccaatacaagcagcaccactcaacaggctagcata |
319 |
Q |
| |
|
||| ||||||||||||||| ||||| |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10599018 |
ttaagtcagtccgaaatccaatcttaaccaccatggcatgaatttgttcacccttaccaattgtaccaatacaagcagcaccactcaagaggctagcata |
10599117 |
T |
 |
| Q |
320 |
taaaaacgaactaact |
335 |
Q |
| |
|
| ||||||||||||| |
|
|
| T |
10599118 |
tgtaaacgaactaact |
10599133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University