View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11550_low_14 (Length: 256)
Name: NF11550_low_14
Description: NF11550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11550_low_14 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 14 - 256
Target Start/End: Complemental strand, 53682818 - 53682576
Alignment:
| Q |
14 |
aggcagagatggaatttgctgtagaagttgaagtgcttggaagggttaggcacaaaaatttgttaggtctaaggggctattgtgttggcgatgatcaaag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53682818 |
aggcagagatggaatttgctgtagaagttgaagtgcttggaagggttaggcacaaaaatttgttaggtctaaggggctattgtgttggcgatgatcaaag |
53682719 |
T |
|
| Q |
114 |
gcttattgtctatgattacatgccaaatctaagtctgctttctcatctccatggtcaatatgctggtgaagtgcaactcaactggcaaaagagaatgagc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53682718 |
gcttattgtctatgattacatgccaaatctaagtctgctttctcatctccatggtcaatatgctggtgaagtgcaactcaactggcaaaagagaatgagc |
53682619 |
T |
|
| Q |
214 |
attgcaattggctctgctgaaggcattttgtaagctttcaccc |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53682618 |
attgcaattggctctgctgaaggcattttgtaagctttcaccc |
53682576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 80
Target Start/End: Complemental strand, 46146709 - 46146645
Alignment:
| Q |
16 |
gcagagatggaatttgctgtagaagttgaagtgcttggaagggttaggcacaaaaatttgttagg |
80 |
Q |
| |
|
||||||||||||||||| || ||||| ||||| || |||||||| ||||| || ||||||||||| |
|
|
| T |
46146709 |
gcagagatggaatttgcagttgaagtggaagtactaggaagggtgaggcataagaatttgttagg |
46146645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University