View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11550_low_15 (Length: 238)
Name: NF11550_low_15
Description: NF11550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11550_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 53682367 - 53682144
Alignment:
| Q |
1 |
taatgttttgcttgattcagattttgtgcctctagttgctgattttggttttgcaaagctaataccagaaggagttagtcacatgacaaccagggttaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53682367 |
taatgttttgcttgattcagattttgtgcctctagttgctgattttggttttgcaaagctaataccagaaggagttagtcacatgacaaccagggttaag |
53682268 |
T |
|
| Q |
101 |
ggtaccttaggatacttagcacctgagtatgctatgtggggaaaagtttctgaaagctgtgatgtctatagttttggaattcttctattagagctagtaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53682267 |
ggtaccttaggatacttagcacctgagtatgctatgtggggaaaagtttctgaaagctgtgatgtctatagttttggaattcttctattagagctagtaa |
53682168 |
T |
|
| Q |
201 |
ctggtagaaagcccatagagaagt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
53682167 |
ctggtagaaagcccatagagaagt |
53682144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 38 - 181
Target Start/End: Complemental strand, 46146085 - 46145942
Alignment:
| Q |
38 |
gctgattttggttttgcaaagctaataccagaaggagttagtcacatgacaaccagggttaagggtaccttaggatacttagcacctgagtatgctatgt |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| || || || | ||||| |||||||| || || | || || || ||||| || |||||||||| |
|
|
| T |
46146085 |
gctgattttggttttgcaaagctaataccagcaggtgtaagccatcttacaacaagggttaaaggcacacttggttatttggcaccagaatatgctatgt |
46145986 |
T |
|
| Q |
138 |
ggggaaaagtttctgaaagctgtgatgtctatagttttggaatt |
181 |
Q |
| |
|
|||| || |||||||| || |||||||| ||||| ||||||||| |
|
|
| T |
46145985 |
ggggtaaggtttctgagagttgtgatgtttatagctttggaatt |
46145942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University