View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11550_low_17 (Length: 229)
Name: NF11550_low_17
Description: NF11550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11550_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 4 - 186
Target Start/End: Complemental strand, 2144525 - 2144342
Alignment:
| Q |
4 |
atatggtagaaacctatgcttataacacttattttggctttatatagttttgagttattagtgttaacaatatagtgtttcagcgaaaataacaaaggaa |
103 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2144525 |
atatggtagaaacctatgcttaaaacacttattttggctttatatagttttgagttattagtgttaacaatatagtgtttcagagaaaataacaaaggaa |
2144426 |
T |
 |
| Q |
104 |
agcggctagggttttcaataataacaatggcataacaaaaagtta-ttgatgagtatcaacaacttatttgatgatgttatatg |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2144425 |
agcggctagggttttcaataataacaatggcataacaaaaagttatttgatgagtatcaacaacttatttgatgatgttatatg |
2144342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University