View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11550_low_19 (Length: 214)
Name: NF11550_low_19
Description: NF11550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11550_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 7e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 17 - 197
Target Start/End: Complemental strand, 38139779 - 38139598
Alignment:
| Q |
17 |
aggcaagttcaaaacagtattacatttaggggnnnnnnn-ggttggtcctgtttagggggactattactgcatctttttaccatgcagcacttgtaaaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38139779 |
aggcaagttcaaaacagtattacatttagggggaaaaaaaggttggtcctgtttagggggactattactgcatctttttaccatgcagcacttgtaaaat |
38139680 |
T |
 |
| Q |
116 |
tcaagaaaacgttggtcctgattctgaaatgccgtccctaaaattaaaatgcaccggatttatgtctttactattaccacac |
197 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38139679 |
tcaagaaaacgttggtcctgtttctgaaatgccgtccctaaaattaaaatgcaccggatttatgtctttactattaccacac |
38139598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 74 - 123
Target Start/End: Complemental strand, 38117515 - 38117466
Alignment:
| Q |
74 |
ggactattactgcatctttttaccatgcagcacttgtaaaattcaagaaa |
123 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
38117515 |
ggactactactgcatctttttaccatgcagcacttacagaattcaagaaa |
38117466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University