View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11552_high_2 (Length: 343)
Name: NF11552_high_2
Description: NF11552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11552_high_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 22 - 322
Target Start/End: Original strand, 28600340 - 28600647
Alignment:
| Q |
22 |
ctcttaattacgaaatgttcgagtaattatgaaacccttaattactatggtaactaataaaattacgggaaatgatacatttagcgacaaatttcatcct |
121 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28600340 |
ctcttaattatgaaatgttcgagtaattataaaacccttaattactatggtaactaataaaattacgggaaatgatacatttagcgacaaatttcatcct |
28600439 |
T |
|
| Q |
122 |
gagagattatcacaacgtgcgaattctatgggtagtggggccctttaattttgatatgctcatgtatttactcatccggtaatgatatgtatcccgagat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28600440 |
gagagattatcacaacgtgcgaattctatgggtagtggggccctttaattttgatatgctcgtgtatttactcattcggtaatgatatgtatcccgagat |
28600539 |
T |
|
| Q |
222 |
tttcacgaccgtattaaaatggcattgctatcacttctttccttttt-------catgtgtaatcatccgatcactaagcggatatgaaaccgttgaaaa |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28600540 |
tttcacgaccgtattaaaatggcattgctatcacttctttcctttttttttcagcatgtgtaatcattcgatcactaagcggatatgaaaccgttgaaaa |
28600639 |
T |
|
| Q |
315 |
catatcgg |
322 |
Q |
| |
|
|||||||| |
|
|
| T |
28600640 |
catatcgg |
28600647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 211 - 268
Target Start/End: Complemental strand, 10587431 - 10587374
Alignment:
| Q |
211 |
tatcccgagattttcacgaccgtattaaaatggcattgctatcacttctttccttttt |
268 |
Q |
| |
|
|||||||| || ||||||||| | |||||||||| ||||||||||||||||||||||| |
|
|
| T |
10587431 |
tatcccgacatattcacgaccttgttaaaatggccttgctatcacttctttccttttt |
10587374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 88 - 193
Target Start/End: Original strand, 10984554 - 10984660
Alignment:
| Q |
88 |
gggaaatgatacatttagcgacaaatttcatcctgagagattatcacaacgt-gcgaat-tctatgggtagtgggg-ccctttaattttgatatgctcat |
184 |
Q |
| |
|
|||||||||||||| | |||||||| ||||||||||| ||||||| || | || ||| |||||||||||||||| ||||||||| ||||| |||||| |
|
|
| T |
10984554 |
gggaaatgatacatgtcgcgacaaaagtcatcctgaga--ttatcacgacattgcaaatgtctatgggtagtggggcccctttaatgttgatttgctcag |
10984651 |
T |
|
| Q |
185 |
gtatttact |
193 |
Q |
| |
|
|||||||| |
|
|
| T |
10984652 |
ttatttact |
10984660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 211 - 268
Target Start/End: Original strand, 51532396 - 51532453
Alignment:
| Q |
211 |
tatcccgagattttcacgaccgtattaaaatggcattgctatcacttctttccttttt |
268 |
Q |
| |
|
||||| ||||| ||||||||| | ||||| |||| |||||||||||| |||||||||| |
|
|
| T |
51532396 |
tatcctgagatattcacgaccttgttaaattggccttgctatcacttatttccttttt |
51532453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 268
Target Start/End: Complemental strand, 16655503 - 16655458
Alignment:
| Q |
223 |
ttcacgaccgtattaaaatggcattgctatcacttctttccttttt |
268 |
Q |
| |
|
||||||||| | ||||||||||||||| |||| ||||||||||||| |
|
|
| T |
16655503 |
ttcacgaccttgttaaaatggcattgccatcatttctttccttttt |
16655458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University