View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11552_high_6 (Length: 286)
Name: NF11552_high_6
Description: NF11552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11552_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 16 - 279
Target Start/End: Complemental strand, 25531224 - 25530961
Alignment:
| Q |
16 |
attattaccattcgagaacacccttgagttttcaatggattcgcgaaatccttgcgaagatttcaaagaatctattgtggaaatggtggaggcttatggt |
115 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25531224 |
attattaccattcaagaacacccttgaggtttcaatggattcgcgaaatccttgcgaagatttcaaagaatctattgtggaaatggtggaggcttatggt |
25531125 |
T |
|
| Q |
116 |
attaacgattgggaaaccctagaaaagcttttgagttggtattttgaagttaatgagaaaagaaatcatggatttattattgatgcnnnnnnngatttat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25531124 |
attaacgattgggaaaccctagaaaagcttttgagttggtattttgaagttaatgagaaaagaaatcatggatttattattgatgctttttttgatttat |
25531025 |
T |
|
| Q |
216 |
ttgttagatttgctcatagttcaccaaattgttctcctttatctattcatagttgttcttctct |
279 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25531024 |
ttgttagatttgatcatggttcaccaaattgttctcctttatctattcatagttgttcttctct |
25530961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University