View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11553_high_14 (Length: 248)
Name: NF11553_high_14
Description: NF11553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11553_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 9 - 111
Target Start/End: Complemental strand, 39126783 - 39126681
Alignment:
| Q |
9 |
agcataggcccaagcccatacaccttgagatttcatgatcccgccactaaacgaaaatcaaaagaacgaatgagataaacattccctcgcatttttttag |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39126783 |
agcacaggcccaagcccatacaccttgagatttcatgatcccgccactaaacgaaaatcaaaagaacgaatgggataaacattccctcgcatttttttag |
39126684 |
T |
|
| Q |
109 |
ccg |
111 |
Q |
| |
|
||| |
|
|
| T |
39126683 |
ccg |
39126681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 183 - 233
Target Start/End: Complemental strand, 39126609 - 39126560
Alignment:
| Q |
183 |
ctgtactctactggttaccatttcaattcaagtcttctcgaggaagtttgt |
233 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39126609 |
ctgtactctactg-ttaccatttcaattcaagtcttctcgaggaagtttgt |
39126560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University