View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11553_high_16 (Length: 226)
Name: NF11553_high_16
Description: NF11553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11553_high_16 |
 |  |
|
| [»] scaffold0754 (1 HSPs) |
 |  |  |
|
| [»] scaffold0563 (6 HSPs) |
 |  |  |
|
| [»] scaffold0543 (1 HSPs) |
 |  |  |
|
| [»] scaffold0492 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 6)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 11 - 208
Target Start/End: Complemental strand, 38849188 - 38848991
Alignment:
| Q |
11 |
gtgagatgaatgtttacaactcaagaccattatatatctgagcaataaaatgtcccacatcgtttagaacaaagcatatgaaacggtttataagcttcca |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38849188 |
gtgacatgaatgtttacaactcaagaccataatatatctgagcaataaaatgtcccacatcgtttagaacaaagcatatgaaacggtttataagcttcca |
38849089 |
T |
 |
| Q |
111 |
acacaggcaattgtttgctgagttgattaacaccaacttgtaacccatgtgggagcatcaaggtgatggaacatggctgtgtcttaacaggttgggct |
208 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38849088 |
acacagggatttgtttgctgagttgattaacaccaacttgtaacccatgtgggagcatcaaggtgatggaacatggctgtgtcttaacaggttgggct |
38848991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 16 - 208
Target Start/End: Original strand, 38749919 - 38750111
Alignment:
| Q |
16 |
atgaatgtttacaactcaagaccattatatatctgagcaataaaatgtcccacatcgtttagaacaaagcatatgaaacggtttataagcttccaacaca |
115 |
Q |
| |
|
|||||| ||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| || |||||||| ||||||||| ||||||||||| |
|
|
| T |
38749919 |
atgaatctttccaactcaagaccataatatatctgagcaataaaatgtcccacatcgtttagaacatagaatatgaaatggtttataaccttccaacaca |
38750018 |
T |
 |
| Q |
116 |
ggcaattgtttgctgagttgattaacaccaacttgtaacccatgtgggagcatcaaggtgatggaacatggctgtgtcttaacaggttgggct |
208 |
Q |
| |
|
| || |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38750019 |
gccatttgtttgctgagttgaataacaccaacttgtaacccatgtgggagcatcaaggtgatggaacatggctgtgtcttaacaggttgggct |
38750111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 10 - 208
Target Start/End: Complemental strand, 39310921 - 39310723
Alignment:
| Q |
10 |
agtgagatgaatgtttacaactcaagaccattatatatctgagcaataaaatgtcccacatcgtttagaacaaagcatatgaaacggtttataagcttcc |
109 |
Q |
| |
|
||||| |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |||| || ||||| || ||||||||| ||||| |
|
|
| T |
39310921 |
agtgacatgaatgtttccaactcaagaccataatatatctgagcaataaaatgtcccacatcgtttaaaacatagaatatgcaatggtttataaacttcc |
39310822 |
T |
 |
| Q |
110 |
aacacaggcaattgtttgctgagttgattaacaccaacttgtaacccatgtgggagcatcaaggtgatggaacatggctgtgtcttaacaggttgggct |
208 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39310821 |
aacacagccaattgttcgctgagttgatttacaccaacttgtaacccatgtgggagcaacaaggtgatggaacatgattgtgtcttaacaggttgggct |
39310723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 50 - 208
Target Start/End: Original strand, 38807281 - 38807439
Alignment:
| Q |
50 |
gagcaataaaatgtcccacatcgtttagaacaaagcatatgaaacggtttataagcttccaacacaggcaattgtttgctgagttgattaacaccaactt |
149 |
Q |
| |
|
||||||||||||||||||||||||||| |||| | ||| || |||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38807281 |
gagcaataaaatgtcccacatcgtttaaaacataattaatgcaatggtttataggcttccaacacagccaattgtttgctgagttgattaacaccaactt |
38807380 |
T |
 |
| Q |
150 |
gtaacccatgtgggagcatcaaggtgatggaacatggctgtgtcttaacaggttgggct |
208 |
Q |
| |
|
|| ||||||||||||||| ||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
38807381 |
gtgacccatgtgggagcaacaaagggatggaacatggctgtgtcttaacaggttgggct |
38807439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 50 - 189
Target Start/End: Complemental strand, 38866137 - 38865998
Alignment:
| Q |
50 |
gagcaataaaatgtcccacatcgtttagaacaaagcatatgaaacggtttataagcttccaacacaggcaattgtttgctgagttgattaacaccaactt |
149 |
Q |
| |
|
||||||||||||||||||||||| |||||||| | ||||| || |||||||| |||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
38866137 |
gagcaataaaatgtcccacatcggttagaacataaaatatgcaattgtttataaacttccaacacagccaattgttcgctgagttgattaacaccaactt |
38866038 |
T |
 |
| Q |
150 |
gtaacccatgtgggagcatcaaggtgatggaacatggctg |
189 |
Q |
| |
|
|| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38866037 |
gtgacccatgtgggagcaccaaggtgatggaacatggctg |
38865998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 50 - 208
Target Start/End: Complemental strand, 38868099 - 38867942
Alignment:
| Q |
50 |
gagcaataaaatgtcccacatcgtttagaacaaagcatatgaaacggtttataagcttccaacacaggcaattgtttgctgagttgattaacaccaactt |
149 |
Q |
| |
|
||||||||||||||| ||||||||||| |||| || ||||| || ||||||| |||||||||||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
38868099 |
gagcaataaaatgtctcacatcgtttaaaacatagaatatgcaatggtttatgtccttccaacacagccaattgttagctga-ttgattaacaccaactt |
38868001 |
T |
 |
| Q |
150 |
gtaacccatgtgggagcatcaaggtgatggaacatggctgtgtcttaacaggttgggct |
208 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38868000 |
gtaacccatgtgggagcattaaggtgatggaacatggacctgtcttaacaggttgggct |
38867942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 129 - 194
Target Start/End: Original strand, 34723177 - 34723241
Alignment:
| Q |
129 |
tgagttgattaacaccaacttgtaacccatgtgggagcatcaaggtgatggaacatggctgtgtct |
194 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||| |||| |||| |||||||||| ||||| |
|
|
| T |
34723177 |
tgagttgattaacaccaacttgtgacccatgtggg-gcaacaagatgattgaacatggctatgtct |
34723241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0754 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0754
Description:
Target: scaffold0754; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 188
Target Start/End: Original strand, 3721 - 3789
Alignment:
| Q |
120 |
attgtttgctgagttgattaacaccaacttgtaacccatgtgggagcatcaaggtgatggaacatggct |
188 |
Q |
| |
|
|||||||||||||||| || | ||||||||| ||||| ||||||||| ||| |||||||||| ||||| |
|
|
| T |
3721 |
attgtttgctgagttggatagcgccaacttgtgacccaagtgggagcaccaaagtgatggaacgtggct |
3789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0563 (Bit Score: 33; Significance: 0.000000001; HSPs: 6)
Name: scaffold0563
Description:
Target: scaffold0563; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 188
Target Start/End: Complemental strand, 1777 - 1709
Alignment:
| Q |
120 |
attgtttgctgagttgattaacaccaacttgtaacccatgtgggagcatcaaggtgatggaacatggct |
188 |
Q |
| |
|
|||||||||||||||| || | ||||||||| ||||| ||||||||| ||| |||||||||| ||||| |
|
|
| T |
1777 |
attgtttgctgagttgggtagcgccaacttgtgacccaagtgggagcaccaaagtgatggaacgtggct |
1709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0563; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 188
Target Start/End: Complemental strand, 3546 - 3478
Alignment:
| Q |
120 |
attgtttgctgagttgattaacaccaacttgtaacccatgtgggagcatcaaggtgatggaacatggct |
188 |
Q |
| |
|
|||||||||||||||| || | ||||||||| ||||| ||||||||| ||| |||||||||| ||||| |
|
|
| T |
3546 |
attgtttgctgagttgggtagcgccaacttgtgacccaagtgggagcaccaaagtgatggaacgtggct |
3478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0563; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 188
Target Start/End: Complemental strand, 5374 - 5306
Alignment:
| Q |
120 |
attgtttgctgagttgattaacaccaacttgtaacccatgtgggagcatcaaggtgatggaacatggct |
188 |
Q |
| |
|
|||||||||||||||| || | ||||||||| ||||| ||||||||| ||| |||||||||| ||||| |
|
|
| T |
5374 |
attgtttgctgagttgggtagcgccaacttgtgacccaagtgggagcaccaaagtgatggaacgtggct |
5306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0563; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 188
Target Start/End: Original strand, 7388 - 7456
Alignment:
| Q |
120 |
attgtttgctgagttgattaacaccaacttgtaacccatgtgggagcatcaaggtgatggaacatggct |
188 |
Q |
| |
|
|||||||||||||||| || | ||||||||| ||||| ||||||||| ||| |||||||||| ||||| |
|
|
| T |
7388 |
attgtttgctgagttgggtagcgccaacttgtgacccaagtgggagcaccaaagtgatggaacgtggct |
7456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0563; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 188
Target Start/End: Original strand, 10253 - 10321
Alignment:
| Q |
120 |
attgtttgctgagttgattaacaccaacttgtaacccatgtgggagcatcaaggtgatggaacatggct |
188 |
Q |
| |
|
|||||||||||||||| || | ||||||||| ||||| ||||||||| ||| |||||||||| ||||| |
|
|
| T |
10253 |
attgtttgctgagttgggtagcgccaacttgtgacccaagtgggagcaccaaagtgatggaacgtggct |
10321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0563; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 188
Target Start/End: Original strand, 571 - 639
Alignment:
| Q |
120 |
attgtttgctgagttgattaacaccaacttgtaacccatgtgggagcatcaaggtgatggaacatggct |
188 |
Q |
| |
|
|||||||||||||||| || | ||||||||| ||||| | ||||||| ||| |||||||||| ||||| |
|
|
| T |
571 |
attgtttgctgagttgggtagcgccaacttgtgacccaagggggagcaccaaagtgatggaacgtggct |
639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0543 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0543
Description:
Target: scaffold0543; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 188
Target Start/End: Complemental strand, 230 - 162
Alignment:
| Q |
120 |
attgtttgctgagttgattaacaccaacttgtaacccatgtgggagcatcaaggtgatggaacatggct |
188 |
Q |
| |
|
|||||||||||||||| || | ||||||||| ||||| ||||||||| ||| |||||||||| ||||| |
|
|
| T |
230 |
attgtttgctgagttggatagcgccaacttgtgacccaagtgggagcaccaaagtgatggaacgtggct |
162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0492 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: scaffold0492
Description:
Target: scaffold0492; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 188
Target Start/End: Original strand, 613 - 681
Alignment:
| Q |
120 |
attgtttgctgagttgattaacaccaacttgtaacccatgtgggagcatcaaggtgatggaacatggct |
188 |
Q |
| |
|
|||||||||||||||| || | ||||||||| ||||| ||||||||| ||| |||||||||| ||||| |
|
|
| T |
613 |
attgtttgctgagttgggtagcgccaacttgtgacccaagtgggagcaccaaagtgatggaacgtggct |
681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0492; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 188
Target Start/End: Complemental strand, 1776 - 1708
Alignment:
| Q |
120 |
attgtttgctgagttgattaacaccaacttgtaacccatgtgggagcatcaaggtgatggaacatggct |
188 |
Q |
| |
|
|||||||||||||||| || | ||||||||| ||||| ||||||||| ||| |||||||||| ||||| |
|
|
| T |
1776 |
attgtttgctgagttgggtagcgccaacttgtgacccaagtgggagcaccaaagtgatggaacgtggct |
1708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 188
Target Start/End: Complemental strand, 15830202 - 15830134
Alignment:
| Q |
120 |
attgtttgctgagttgattaacaccaacttgtaacccatgtgggagcatcaaggtgatggaacatggct |
188 |
Q |
| |
|
|||||||||||||||| || | ||||||||| ||||| ||||||||| ||| |||||||||| ||||| |
|
|
| T |
15830202 |
attgtttgctgagttgggtagcgccaacttgtgacccaagtgggagcaccaaagtgatggaacgtggct |
15830134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 144 - 188
Target Start/End: Complemental strand, 46621652 - 46621608
Alignment:
| Q |
144 |
caacttgtaacccatgtgggagcatcaaggtgatggaacatggct |
188 |
Q |
| |
|
|||||||||||||| ||||| |||| ||||||||||||||||||| |
|
|
| T |
46621652 |
caacttgtaacccaagtgggggcatgaaggtgatggaacatggct |
46621608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 188
Target Start/End: Complemental strand, 15831930 - 15831862
Alignment:
| Q |
120 |
attgtttgctgagttgattaacaccaacttgtaacccatgtgggagcatcaaggtgatggaacatggct |
188 |
Q |
| |
|
|||||||||||||||| || | ||||||||| ||||| | ||||||| ||| |||||||||| ||||| |
|
|
| T |
15831930 |
attgtttgctgagttgggtagcgccaacttgtgacccaagggggagcaccaaagtgatggaacgtggct |
15831862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 188
Target Start/End: Complemental strand, 15833657 - 15833589
Alignment:
| Q |
120 |
attgtttgctgagttgattaacaccaacttgtaacccatgtgggagcatcaaggtgatggaacatggct |
188 |
Q |
| |
|
|||||||||||||||| || | ||||||||| ||||| | ||||||| ||| |||||||||| ||||| |
|
|
| T |
15833657 |
attgtttgctgagttgggtagcgccaacttgtgacccaagggggagcaccaaagtgatggaacgtggct |
15833589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 144 - 188
Target Start/End: Complemental strand, 46627385 - 46627341
Alignment:
| Q |
144 |
caacttgtaacccatgtgggagcatcaaggtgatggaacatggct |
188 |
Q |
| |
|
||||||||||| || ||||| |||| ||||||||||||||||||| |
|
|
| T |
46627385 |
caacttgtaactcaagtgggggcatgaaggtgatggaacatggct |
46627341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University