View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11553_low_19 (Length: 217)
Name: NF11553_low_19
Description: NF11553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11553_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 34 - 203
Target Start/End: Complemental strand, 33434292 - 33434123
Alignment:
| Q |
34 |
atttctcctataatcgtaacctttattgatgctttctaccaaaaatcaaacacgtatttatacccgtaaggtgtaactaagttaagaaataaatacaaaa |
133 |
Q |
| |
|
|||| |||||||||||||||| |||||||| ||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33434292 |
atttgtcctataatcgtaaccattattgatactttctaccaaaattcaaaaacgtatttatacccgtaaggtgtaactaagttaagaaataaatacgaaa |
33434193 |
T |
 |
| Q |
134 |
tagataaccaaacaagatgaaatgatatattaacataaagggagattttgtttggccggtgcaccctatg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33434192 |
tagataaccaaacaagatgaaatgatatattaacataaagggagattttgcttggccggtgcaccctatg |
33434123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University