View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11554_high_12 (Length: 331)
Name: NF11554_high_12
Description: NF11554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11554_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 86 - 323
Target Start/End: Complemental strand, 25825964 - 25825721
Alignment:
| Q |
86 |
gatcattcaaatgatgaaactctctactcaaactcaaactc------caacttcatcttgttcaaatgtatctccaccaatgtgtagcagctccaaatcc |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25825964 |
gatcattcaaatgatgaaactctcaactcaaactcaaactcaaactccaacttcatcttgttcaaatgtatctccaccaatgtgtagcagctccaaatcc |
25825865 |
T |
 |
| Q |
180 |
acaactacaggatgtctcacagccatcatgcgcaagattctttgctccggaaaccttccaaaagactcgtcgaatcaaaccacagaatttgattcagcaa |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25825864 |
acaactacaggatgtctcacagccatcatgcgcaagattctttgctccggaaaccttccaaaagactcgtcgaatcaaaccacagaatttgattcagcaa |
25825765 |
T |
 |
| Q |
280 |
attctgttctaagtgtaaatgatcacaacttcggcgtctctgct |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
25825764 |
attctgttctaagtgtaaatgatcacaacttgggcgtttctgct |
25825721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University