View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11554_high_19 (Length: 253)
Name: NF11554_high_19
Description: NF11554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11554_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 10461391 - 10461617
Alignment:
| Q |
1 |
caaacgagtagaagtttcattggaggcatatcaataggtacaatttggatctaaaacatgtctgaaaacaaggtttcttttagcgaggattcgattccaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10461391 |
caaacgagtagaagtttcattggaggcatcttaataggtacaatttggatctaaaacatgtc-gcaaacaaggtttcttttagcgaggattcgattccaa |
10461489 |
T |
 |
| Q |
101 |
agatgttttcaagaaaacgccatcactttctttgcagtcggacttttctaattgaaatcatgtctctgttctcttaaaataaattctggtttgttttcta |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||| | |||| |||||||| ||||||||| ||||| |||| |||||||||||||||||| |||||||| || |
|
|
| T |
10461490 |
agatgttttcaagaaaatgccatcactttcttcggagtcagacttttc-aattgaaattatgtccctgtgctcttaaaataaattctgttttgttttata |
10461588 |
T |
 |
| Q |
201 |
acgtggttggttgtcatggactgtcttca |
229 |
Q |
| |
|
||| ||| |||||||||||| | |||||| |
|
|
| T |
10461589 |
acgcggtcggttgtcatggattctcttca |
10461617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University