View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11554_high_8 (Length: 404)

Name: NF11554_high_8
Description: NF11554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11554_high_8
NF11554_high_8
[»] chr4 (1 HSPs)
chr4 (1-94)||(10461724-10461816)
[»] chr6 (1 HSPs)
chr6 (333-377)||(10945953-10945997)


Alignment Details
Target: chr4 (Bit Score: 58; Significance: 3e-24; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 10461724 - 10461816
Alignment:
1 tctatattgattaacttatcacagaggaagcgaatcattgttgataaaaacattcgaattaacatgaaatgaatcaaacacttatgacttcaac 94  Q
    ||||||||||||||||||||||||||||||| || |  |||||||||||||||||||| ||||||||| |||||||||||||| ||| ||||||    
10461724 tctatattgattaacttatcacagaggaagcaaagctatgttgataaaaacattcgaa-taacatgaactgaatcaaacacttttgatttcaac 10461816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 333 - 377
Target Start/End: Complemental strand, 10945997 - 10945953
Alignment:
333 aaaggcaaatgctgcatgttacgaactgcacacaaagaaaaacaa 377  Q
    ||||||||||||| |||||||||||||||||||||||||||||||    
10945997 aaaggcaaatgcttcatgttacgaactgcacacaaagaaaaacaa 10945953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University