View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11554_low_19 (Length: 253)

Name: NF11554_low_19
Description: NF11554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11554_low_19
NF11554_low_19
[»] chr4 (1 HSPs)
chr4 (1-229)||(10461391-10461617)


Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 10461391 - 10461617
Alignment:
1 caaacgagtagaagtttcattggaggcatatcaataggtacaatttggatctaaaacatgtctgaaaacaaggtttcttttagcgaggattcgattccaa 100  Q
    ||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||    
10461391 caaacgagtagaagtttcattggaggcatcttaataggtacaatttggatctaaaacatgtc-gcaaacaaggtttcttttagcgaggattcgattccaa 10461489  T
101 agatgttttcaagaaaacgccatcactttctttgcagtcggacttttctaattgaaatcatgtctctgttctcttaaaataaattctggtttgttttcta 200  Q
    ||||||||||||||||| |||||||||||||| | |||| |||||||| ||||||||| ||||| |||| |||||||||||||||||| |||||||| ||    
10461490 agatgttttcaagaaaatgccatcactttcttcggagtcagacttttc-aattgaaattatgtccctgtgctcttaaaataaattctgttttgttttata 10461588  T
201 acgtggttggttgtcatggactgtcttca 229  Q
    ||| ||| |||||||||||| | ||||||    
10461589 acgcggtcggttgtcatggattctcttca 10461617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University