View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11554_low_5 (Length: 517)
Name: NF11554_low_5
Description: NF11554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11554_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 332; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 163 - 502
Target Start/End: Complemental strand, 48392867 - 48392528
Alignment:
| Q |
163 |
gtcatcaaccgacgaagatcggagtttagaagaaattaccagaggaagaatatcggcgggagcagatcggagtttagagggaagatcagggtcaaaagag |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48392867 |
gtcatcaaccgacgaagatcggagtttagaagaaattaccagaggaagaatatcggcgggagcagatcggagtttagagggaagatcagggtcaaaagag |
48392768 |
T |
|
| Q |
263 |
tcaagatcttccatatcaacgagaagatatttgggattatggagaagactttctctgtaagggaagacattgttaccggtttcgaagttacggatgaatt |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48392767 |
tcaagatcttccatatcaacgagaagatatttgggattatggaggagactttctctgtaagggaagacattgttaccggtttcgaagttacggatgaatt |
48392668 |
T |
|
| Q |
363 |
ctttgaatttttgaagaatggtgtggttggagatggtggcgtcggtttcgccgccgcggccgtcgtcccatgagtgtgcttggtcgctatagtatacgcc |
462 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48392667 |
ctttgaatttttgaagaatggtgtggttggagatggcggcgtcggtttcgccgccgcggccgtcgtcccatgagtgtgcttggtcgctatagtatacgcc |
48392568 |
T |
|
| Q |
463 |
tccttcgtcccaacctgacattgtttagatctctgatttg |
502 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48392567 |
tccttcgtcccaacctgacattgtttagatctctgatttg |
48392528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 16 - 103
Target Start/End: Complemental strand, 48393014 - 48392927
Alignment:
| Q |
16 |
acatcaccaggagcagcatcttccatatcaccagtatctccagcaaccttcgtcttcaaactcaccaaaacctgcgccgccgcagttt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48393014 |
acatcaccaggagcagcatcttccatatcaccagtatctccagcaaccttcgtcttcaaactcaccaaaacctgcgccgccgcagttt |
48392927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University