View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11555_high_15 (Length: 235)

Name: NF11555_high_15
Description: NF11555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11555_high_15
NF11555_high_15
[»] chr2 (1 HSPs)
chr2 (17-218)||(6577891-6578092)


Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 17 - 218
Target Start/End: Original strand, 6577891 - 6578092
Alignment:
17 aattgatgagggtgggttactgcagatgtgataaagagaaatgcagagaaaatcaaagaaccgctaagaaatcaaggaacccannnnnnnaattagagaa 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||    
6577891 aattgatgagggtgggttactgcagatgtgataaagagaaatgcagagaaaatcaaagaaccgctaagaaatcaaggaacccatttttttaattagagaa 6577990  T
117 ataactcatgtttaccatgtagaaaaagcaagtatttaacttgttgagctttgatagtgtgttttagcagaattctttttgatgattattaaaataggtt 216  Q
    |||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6577991 ataactcatgtttaccatatagaaagagcaagtatttaacttgttgagctttgatagtgtgttttagcagaattctttttgatgattattaaaataggtt 6578090  T
217 tc 218  Q
    ||    
6578091 tc 6578092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University