View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11555_high_9 (Length: 292)
Name: NF11555_high_9
Description: NF11555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11555_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 6e-77; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 132 - 285
Target Start/End: Complemental strand, 20532248 - 20532095
Alignment:
| Q |
132 |
gtcctttccaacctattaattcgttccgtcaaacctcggaatttccaacatagttctcctatgtcaccacttactcagaaggatttcacaagttcaccac |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20532248 |
gtcctttccaacctattaattcgttccgtcaaacctcggaatttccaacatagttctcctatgtcaccacttactccgaaggatttcacaagttcaccac |
20532149 |
T |
 |
| Q |
232 |
ttgaattcataagcccttctttttcttcaccccacttaggtatgtctctctgct |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20532148 |
ttgaattcataagcccttctttttcttcaccccacttaggtatgtctctttgct |
20532095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 16 - 59
Target Start/End: Complemental strand, 20532364 - 20532321
Alignment:
| Q |
16 |
caaacctcatcggaaaacgtacctttgatgaatttcaatcccaa |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20532364 |
caaacctcatcggaaaacgtacctttgatgaatttcaatcccaa |
20532321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 77; Significance: 9e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 136 - 256
Target Start/End: Complemental strand, 2826197 - 2826077
Alignment:
| Q |
136 |
tttccaacctattaattcgttccgtcaaacctcggaatttccaacatagttctcctatgtcaccacttactcagaaggatttcacaagttcaccacttga |
235 |
Q |
| |
|
||||||||||||||||| |||| |||||||| || |||||||||||||||||||||||||||||||| ||| | |||||||||||||| |||||||| |
|
|
| T |
2826197 |
tttccaacctattaatttgttctatcaaacctaggtatttccaacatagttctcctatgtcaccactttctccaatggatttcacaagtttgccacttga |
2826098 |
T |
 |
| Q |
236 |
attcataagcccttctttttc |
256 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
2826097 |
attcataagcccttctttttc |
2826077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University