View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11555_low_13 (Length: 249)
Name: NF11555_low_13
Description: NF11555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11555_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 42375314 - 42375073
Alignment:
| Q |
1 |
agcagtacgtgcaccttggtcaaaagttataccttcggcaaccacaccgttttcctttaagatcccggcaagcatgtgaccgaactcgtcatcgcctagt |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42375314 |
agcagtacgtgcaccttggtcaaaggttataccttcggcaaccacaccgttttcctttaagatcccggcaagcatgtgaccgaactcgtcatcgcctagt |
42375215 |
T |
 |
| Q |
101 |
ttcccgacaaaggcggctttaccgcctaatcgggaaacagcgatggcaacgttcgctggtgcaccgccgggagctttgaggaaaccgggggcttctgcga |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42375214 |
ttcccgacaaaggcagctttaccgcctaatcgggaaacagcgatggcgacgttcgctggtgcaccgccgggagctttgaggaaaccgggggcttctgcga |
42375115 |
T |
 |
| Q |
201 |
gggagaccccagagactgttgggacaaagtcgatcagcatct |
242 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42375114 |
gggagaccccggagactgttgggacaaagtcgatcagcatct |
42375073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 49 - 207
Target Start/End: Complemental strand, 25408293 - 25408135
Alignment:
| Q |
49 |
gttttcctttaagatcccggcaagcatgtgaccgaactcgtcatcgcctagtttcccgacaaaggcggctttaccgcctaatcgggaaacagcgatggca |
148 |
Q |
| |
|
|||||| || ||||||||||| |||||||||||||| || ||||| || ||||| ||||| ||||| | |||||| || | ||| ||||||||||| ||| |
|
|
| T |
25408293 |
gttttctttcaagatcccggcgagcatgtgaccgaattcatcatcaccgagttttccgacgaaggctgatttaccaccgagtcgtgaaacagcgatcgca |
25408194 |
T |
 |
| Q |
149 |
acgttcgctggtgcaccgccgggagctttgaggaaaccgggggcttctgcgagggagac |
207 |
Q |
| |
|
||||| || ||||| || |||||||||||||| || || || |||||||| |||||||| |
|
|
| T |
25408193 |
acgttagcgggtgcgccaccgggagctttgagaaagccaggtgcttctgcaagggagac |
25408135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University